800 007 970 (Gratuito para españa)
658 598 996
·WhatsApp·

4 jun 2012

Influencia de los polimorfismos del gen actn-3 en la velocidad de respuesta de los flexores y extensores de la rodilla en jugadores profesionales de voleibol

/
Enviado por
/
Comentarios0
/
Etiquetas, ,
Introducción: El gen ACTN3 codifica la presencia de proteínas intramusculares que pueden conferir beneficios en deportes de sprint/potencia como el voleibol.
Autor(es): Diez Vega, I., Rodríguez-Ruiz, D.2, Fernández-del Valle, M. ,Molina Martín, J.J.
Entidades(es): Universidad Europea de Madrid, Universidad de Las Palmas de Gran Canaria.
Congreso: VII Congreso Nacional de Ciencias del deporte y educación Física
Pontevedra - 5, 6 y 7 de Mayo de 2011
ISBN: 978-84-614-9945-8
Palabras claves: polimorfismo ACTN3, Tensomiografía, Velocidad de respuesta muscular, voleibol.

Influencia de los polimorfismos del gen actn-3 en la velocidad de respuesta de los flexores y extensores de la rodilla en jugadores profesionales de voleibol

Resumen

Introducción: El gen ACTN3 codifica la presencia de proteínas intramusculares que pueden conferir beneficios en deportes de sprint/potencia como el voleibol. Desde un punto de vista mecánico, en gran parte de las acciones técnicas del voleibol está presente un movimiento conocido como “mecanismo de triple extensión” en las articulaciones del tobillo, rodilla y cadera. Dadas las diferencias morfológicas, musculares y condicionales, que pueden modular cualitativamente del rendimiento, es necesario evaluarlas de un modo individualizado, preciso y localizado. Esto se ha conseguido utilizando la tensomiografía (TMG) como instrumento de monitorización. El objetivo de este estudio ha sido evaluar la velocidad de respuesta de los flexores y extensores de la rodilla en función de los genotipos de ?-actinina-3.  Material y método: La muestra está compuesta por 75 jugadores profesionales de voleibol. Para el análisis de los datos se utilizó un análisis ANOVA, con el programa SPSS v15.0. Resultados: La distribución de los polimorfismos de ACTN3 fue: XX el 29,3%; RX el 52 % y RR el 18,7 %. Se encontraron diferencias estadísticamente significativas en la Velocidad de respuesta normalizada (Vrn) del Recto Femoral (f = 3,27; p<0,05) y del Vasto Lateral (f = 5,51; p<0,01) en función del genotipo. Conclusiones: La distribución de ACTN3 en jugadores de voleibol difiere de la encontrada en población caucásica de nacionalidad española. El polimorfismo XX no influye negativamente en la capacidad de desarrollo de fuerza explosiva en jugadores de voleibol de alto nivel. No podemos afirmar que el gen ACTN3 sea determinante del rendimiento en el voleibol de alto nivel, existiendo otros factores fenotípicos capaces de modular dicho rendimiento.

Introducción

Las ?-actininas forman una amplia familia de proteínas que se encuentran presentes en gran variedad de tejidos y juegan un papel importante en las contracciones musculares en distintas especies (MacArthur et al., 2004)(1). Dos de ellas son de interés primordial para el ámbito de la actividad física y el deporte: las ?-actinina-2 y ?-actinina-3. Ambas, se expresan en las células del músculo esquelético y constituyen el componente predominante de la línea Z del sarcómero (Squire et al., 1997)(2). El músculo esquelético está constituido por múltiples fibras musculares, agrupadas en tipo I y tipo II, según las características metabólicas y contráctiles (Mills et al., 2001)(3). Las fibras tipo I dependen predominantemente del metabolismo aeróbico y parecen tener menor nivel de explosividad de contracción, al contrario que las fibras de tipo II. La ?-actinina-2 se expresa en ambos tipos de fibras, mientras que la ?-actinina-3 (codificada por el gen ACTN3) solamente se ha encontrado en las fibras musculares tipo II (rápidas o glucolíticas), que tienen una explosividad de contracción más alta y dependen del metabolismo anaeróbico. El gen ACTN3 es el encargado de codificar la síntesis de la proteína ?-actinina-3, presente en las bandas Z musculares, permitiendo una contacción explosiva (MacArthur et al., 2004)(1). A priori puede afirmarse que la presencia de ?-actinina-3 confiere algunos beneficios a deportistas de sprint/potencia, que necesitan generar contracciones rápidas y explosivas en su deporte; apareciendo este efecto más acusado en deportistas femeninas. (Yang et al., 2003)(4). Además, la ausencia de ?-actinina-3 (asociada con el genotipo 577X) parece ser más frecuente en atletas de resistencia, aunque los resultados alcanzan una significación estadística solamente en atletas femeninas. De esta forma, existe la posibilidad de que el genotipo XX produzca beneficios fisiológicos a sus portadores para deportes de resistencia, en los que la eficiencia muscular y la resistencia aeróbica son de mayor importancia que la velocidad o explosividad. Por todo ello, sería posible considerar al gen ACTN3 como el primer gen estructural del músculo esquelético, llegando a ser denominado durante algún tiempo como “el gen de la velocidad”. Pero algunos de los últimos estudios parecen poner en duda la importancia de este gen en el desarrollo de la manifestación explosiva de la fuerza (Lucía et al., 2007 (5); Ruiz et al., 2010 (6); Santiago et al., 2010 (7)), aunque sí que se ha demostrado una asociación fenotipo/genotipo con el rendimiento deportivo. (MacArthur et al., 2007)(8). Por lo tanto, quedan y surgen nuevas dudas sobre si el gen ACTN3 es realmente el gen de la velocidad, y si la ausencia del polimorfismo RR es limitante en determinados deportes de marcada explosividad, como el voleibol. En voleibol podemos observar, desde el punto de vista mecánico, que durante la realización de las acciones técnicas, los jugadores realizan un movimiento que se conoce como mecanismo de triple extensión (extensión de las articulaciones del tobillo, rodilla y cadera). Este mecanismo resulta especialmente útil en gran parte de los gestos técnicos, y especialmente en aquellos que involucran una acción de salto durante su ejecución (Rodríguez-Ruiz, 1999)(9) . El desarrollo de dichos gestos depende del buen hacer de los deportistas, y su eficacia depende de factores técnicos, tácticos y condicionales. También resulta determinante el proceso de aprendizaje y automatización que el jugador haya experimentado durante su formación. En este sentido, la especilización para poder llegar al alto rendimiento en una modalidad deportiva implica una estandarización de los métodos de entrenamiento para lograr  adaptaciones estructurales y neurales que respondan adecuadamente a las exigencias propias de la actividad a desarrollar. Éste hecho ocurre por igual sin distinción de género, ya que los grupos musculares que deben ser entrenados son los mismo en ambos sexos. No obstante, parecen existir diferencias morfológicas, musculares y condicionales, que pueden convertirse en variables cualitativamente diferenciadoras del rendimiento de ambos sexos. La mayor sección transversal de los musculos (Ikai et al., 1968 (10); Laubach, 1976 (11); Bishop et al., 1987 (12)), la mayor activación de la musculatura isquiotibial que se observa en el el aterrizaje después del salto y/o la coactivación que se produce entre la musculatura flexiora y extensora de la articulación de la rodilla durante los saltos o los cambios de dirección (Malinzak et al., 2001 (13); Lephart et al., 2002 (14); Decker et al., 2003 (15); Salci et al., 2004 (16); Padua et al., 2005 (17); Kernozek et al., 2005 (18); Ford et al., 2006 (19); Hewett et al., 2006 (20); Yu et al., 2006 (21); Pappas et al., 2007 (22); Hughes et al., 2008 (23) y Orishimo et al., 2009 (24)), son algunas de las diferencias más destacadas que podemos encontrar entre hombres y mujeres. Por estas razones, es necesario realizar una evaluación muy precisa, individualizada y localizada, de aquellas estructuras musculares que con mayor frecuencia son utilizadas en la práctica del voleibol. En este sentido, la tensiomiografía (TMG), se muestra como un método de diagnóstico, no invasivo, que no requiere ningún esfuerzo por parte del sujeto al que se aplica y que puede ser especialmente útil en el control de estructuras musculares. Esta técnica se utiliza para evaluar la rigidez, las características mecánicas y la capacidad contráctil de los músculos superficiales cuando son activados por un estímulo eléctrico de intensidad controlada (Valencic, 1990 (25), Valencic et al., 1997 (26), Dahmane et al., 2000 (27), Valencic et al., 2000 (28), Dahmane et al., 2001 (29), Valencic et al., 2001 (30), Pisot et al., 2002 (31), Simunic, 2003, Dahmane et al., 2005 (32), Dahmane et al., 2006 (33)). Mide los cambios geométricos (desplazamiento radial) que ocurren en el vientre muscular cuando se produce la contracción. Estos parámetros, expresados por el desplazamiento del sensor y por el tiempo en que éste se produce, son utilizados para evaluar la rigidez muscular y el balance entre estructuras musculares, cadenas musculares (flexora-extensora) o extremidades (derecha-izquierda). Por todo, lo expuesto anteriormente, podemos considerar a la TMG como instrumento de evaluación de las características mecánicas de la musculatura nos asegura la monitorización de la respuesta muscular de  cada uno de los musculos implicados durante el salto: vasto medial (VM), recto femoral (RF), vasto lateral (VL) y bíceps femoral (BF). Y, por lo tanto, aplicarlo a la monitorización y estudio de las diferencias existentes entre los distintos músculos implicados en la flexión y extensión de la rodilla en jugadores de voleibol de alto nivel. Dados estos antecedentes, el objetivo del estudio fue comparar la velocidad de respuesta muscular (Vrn) de los flexores y extensores de la rodilla en función de la presencia en jugadores de voleibol de alto nivel de los genotipos de ?-actinina-3 (ACTN3), divididos en los polimorfismos XX, RX y RR.  

Completa la información

Contenido disponible en el CD Colección Congresos nº15.

¡Consíguelo aquí!

Material y método.

Muestra La muestra de este estudio está compuesta por 75 jugadores pertenecientes a 8 equipos españoles de Superliga masculina de voleibol. La recogida de datos se llevó a cabo entre los meses de agosto y septiembre del año 2010, previos al inicio de la temporada competitiva. Las características de la población estudiada se pueden observar en la tabla 1. Tabla 1. Características morfológicas de la muestra

Contenido disponible en el CD Colección Congresos nº 15

                                                                       Todos los participantes fueron informados del riesgo potencial asociado al estudio y firmaron el pertinente consentimiento informado, previamente aprobado por el Comité Ético de la Universidad de Europea de Madrid, siguiendo los criterios de la Declaración de Helsinki para la investigación con muestras biológicas en seres humanos. Procedimiento de medición Se llevó a cabo una valoración genotípica del gen ACTN-3, y fenotípica de la Velocidad de Respuesta Normalizada (Vrn) de los flexores (Bíceps Femoral) y extensores (Vasto Medial, Vasto Lateral y Recto Femoral) de la rodilla. Caracterización genotípica. Con objeto de comprobar los diferentes polimorfismos del gen ACTN3 (RR, RX, y XX), se recogieron muestras de saliva mediante el uso de tourundas siguiendo las recomendaciones de Chanock et al. (2007)(34), acerca de los estudios de asociación genotipo-fenotipo en humanos. El análisis genotípico se llevó a cabo en el Laboratorio de Biomedicina de la Universidad Europea de Madrid siguiendo la metodología descrita por Mills et al. (2001)(3) y Lucía et al. (2006) (35).
  • En primer lugar se procedió a la purificación de las muestras mediante la aplicación de técnicas rutinarias de separación con fenol/cloroformo seguido de varios pasos de precipitación con isopropanol y etanol 70%.
  • A continuación, se utilizó la técnica de amplificación de ADN, conocida como Reacción en Cadena de la Polimerasa (PCR), con el fin de obtener una cantidad suficiente ADN para ser analizado. Esta técnica consta de tres fases: desnaturalización, hibridación y extensión.
    • La desnaturalización consiste en la separación de cada una de las dos hebras que constituyen el ADN molde o sustrato.
    • La hibridación se desarrolla en presencia de primers o cebadores con altas concentraciones de oligonucleótidos sintéticos, que son complementarios a ciertas zonas del ADN molde.
    • En la extensión se elonga el complejo cebador-ADN molde en sentido 5’?3’ por parte de la ADN-polimerasa. De cada copia de ADN molde se obtienen dos copias de la secuencia diana, que a su vez va a servir como molde para los ciclos sucesivos.
  • Una vez se obtienen suficientes secuencias diana para ser analizadas, se procede a determinar los genotipos del gen ACTN3, mediante análisis de curvas de desnaturalización de los productos de PCR previamente amplificados (empleando los siguientes primers: ACTN3 - rev 5’- GGGCTGAGGGTGATGTAGGGATTGG - 3’ y ACTN3 - as 5’- CTGCGGGCTGAGGGTGATGTAGG - 3’, mediante procesos de transferencia de energía entre los fluoróforos de las siguientes sondas: ACTN3i-fw 5’-ACGATCAGTTCAAGGCAACACT XT CCCG-3’ y 557R-Sen T 5’-TCGCTCTCAGTCAGCCTCG—FL 3’ en un equipo de PCR a tiempo real Ligth Cycler (Roche) (Mills et al., 2001)(3).
Caracterización fenotípica. Se analizó el comportamiento mecánico de los vientres musculares relacionados con la flexión y la extensión de rodilla, a través de un Tensomiógrafo TMG-BMC. En concreto, se analizó la Velocidad de Respuesta Normalizada en el principal flexor de rodilla (Bíceps Femoral), y en el grupo extensor (Vasto Lateral, Recto Femoral y Vasto Medial del cuádriceps), por entender que son grupos musculares determinantes del rendimiento en el voleibol, dada la importancia de la capacidad de salto y de la velocidad de desplazamiento en este deporte.  La Tensomiografía utiliza un sensor de presión colocado de forma perpendicular al vientre muscular (Valencic et al., 1997)(26), tras colocar el segmento corporal analizado siguiendo las recomendaciones del fabricante (Djorjevic et al., 2000 (36), Simunic et al., 2001 (37), Gorelick et al., 2007 (38)) (véanse ilustraciones 1 y 2). Ilustración 1. Procedimiento de medición de TMG

Contenido disponible en el CD Colección Congresos nº 15

Para inducir la contracción se aplica una corriente eléctrica bipolar, de intensidad única (110 mA) y un milisegundo de duración, a través de dos electrodos situados en los extremos proximal y distal del vientre muscular, evitando estimular los tendones de inserción (Knez et al., 2000 (39); Valencic, 2002 (40); Simunic, 2003 (41)), conservando el tiempo de pausa entre estímulos para evitar el fenómeno de activación post-tetánica (Belic et al., 2000 (42), Simunic, 2003 (41), Rodríguez-Matoso, et al. 2010 (43)). La reproducibilidad del método y la validez del protocolo experimental de la Tensomiografía han sido estudiadas en diferentes trabajos, presentándose como una herramienta de alta precisión (Dahmane et al., 2000 (27); Belic et al., 2000 (42), Simunic, 2001 y 2003 (37, 41), Krizaj, 2008 (44); Tous-Fajardo et al., 2010 (45); Rodríguez-Matoso et al., 2010 (43)). Ilustración 2. Colocación de los segmentos evaluados

Contenido disponible en el CD Colección Congresos nº 15

Una vez evaluado el músculo deseado, se dispone de información numérica sobre la magnitud de los desplazamientos radiales de las fibras transversales musculares y del momento en que éstos se producen (Valencic y Knez, 1997 (26); Simunic, 2003 (41)). De todos los datos obtenidos nos centramos en el estudio de la Velocidad de respuesta normalizada (Vrn). La Velocidad de respuesta normalizada (Vrn) es el valor resultante del cociente entre la diferencia de la deformación producida entre el 10% y el 90% de la Deformación Máxima  y el incremento de tiempo entre esos mismos valores  (Eq.1). Valencic et al. (1997)(26) apuntan que para comparar los valores obtenidos en músculos diferentes, resulta indispensable normalizar este incremento de tiempo. La forma de conseguirlo es dividir la ecuación realizada anteriormente por la Deformación Máxima de cada musculo (Eq. 2). Valencic et al. (1997)(26) y Simunic (2003)(41) nos indican que el producto de  y Dm es igual a una constante cuyo valor es 0,8. Por tanto, Vrn es igual a este valor (0,8) dividido por ?tr (Eq. 3): Una vez evaluado el músculo deseado, se dispone de información numérica sobre la magnitud de los desplazamientos radiales de las fibras transversales musculares y del momento en que éstos se producen (Valencic y Knez, 1997 (26); Simunic, 2003 (41)). De todos los datos obtenidos nos centramos en el estudio de la Velocidad de respuesta normalizada (Vrn). La Velocidad de respuesta normalizada (Vrn) es el valor resultante del cociente entre la diferencia de la deformación producida entre el 10% y el 90% de la Deformación Máxima  y el incremento de tiempo entre esos mismos valores  (Eq.1). Valencic et al. (1997)(26) apuntan que para comparar los valores obtenidos en músculos diferentes, resulta indispensable normalizar este incremento de tiempo. La forma de conseguirlo es dividir la ecuación realizada anteriormente por la Deformación Máxima de cada musculo (Eq. 2). Valencic et al. (1997)(26) y Simunic (2003)(41) nos indican que el producto de  y Dm es igual a una constante cuyo valor es 0,8. Por tanto, Vrn es igual a este valor (0,8) dividido por ?tr (Eq. 3): Análisis Estadístico Inicialmente, se aplicó la prueba de Kolmogorov-Smirnov para verificar la distribución normal de los datos. A continuación se efectuó el análisis de la Vrn en el VM, RF, VL y BF a través de un análisis ANOVA, empleando los genotipos del gen ACTN3 como variable de agrupación. Para efectuar la comparación entre grupos se utilizó la prueba de comparaciones múltiples por pares de Bonferroni, con nivel de significación ?=0,05. Con objeto de confirmar estas diferencias, se utilizó un T-test para muestras independientes, comparando las categorías que mostraban diferencias entre sí. Toda la estadística fue realizada utilizando el paquete estadístico SPSS-v15 (SPSS Inc., Chicago, IL, USA).  

Resultados.

En cuanto a la distribución de los polimorfismos del gen ACTN3, el 29,3% de la muestra pertenecen al grupo XX, el 52 % grupo RX y el 18,7 % restante al grupo RR tal y como aparece reflejado en el gráfico 1. Gráfico 1. Distribución de frecuencias del gen ACTN-3

Contenido disponible en el CD Colección Congresos nº 15

En el análisis comparativo de la Vrn en función del tipo de polimorfismo se encontraron diferencias estadísticamente significativas en los casos del Recto Femoral (f = 3,27; p<0,05) y del Vasto Lateral (f = 5,51; p<0,01). Sin embargo, no se hallaron diferencias en el comportamiento de la Vrn en la musculatura del Vasto Medial del cuádriceps y del Bíceps Femoral (Gráfico 2). Gráfico 2. Análisis de la Vrn en función de los polimorfismos del gen ACTN3

Contenido disponible en el CD Colección Congresos nº 15

El análisis por pares reveló diferencias significativas en la Vrn del RF (t=2,38; p<0,05) y VL (t=3,44; p<0,001) entre los genotipos RX y el RR (gráficos 3 y 4 respectivamente) Gráfico 3. Diferencia de Vrn en VL entre los polimorfismos de RX-RR del gen ACTN3

Contenido disponible en el CD Colección Congresos nº 15

Gráfico 4. Diferencia de Vrn en RF entre los polimorfismos de RX-RR del gen ACTN3

Contenido disponible en el CD Colección Congresos nº 15

Sin embargo, no se encontraron diferencias significativas en función del genotipo en la Vrn de los músculos bíceps femoral y vasto medial del cuádriceps (gráficos 5 y 6). Gráficos 5 y 6. Diferencia de Vrn del VM y BF entre los polimorfismos del gen ACTN3

Contenido disponible en el CD Colección Congresos nº 15

Discusión.

Por un lado, la distribución de los polimorfismos del gen ACTN3, difiere de la distribución de la población española no deportista siendo el RX el genotipo más representado en ambos casos, con porcentajes en torno al 50% (Lucia et al, 2006)(35). Sin embargo, la presencia del genotipo RR (31%) predomina sobre el XX (20%) en una población española de sujetos no deportistas, mientras que en el presente estudio la frecuencia del polimorfismo XX (29%) predomina sobre el RR (19%) (Lucia et al, 2006 (35); Ruiz et al, 2010 (6)), y también en población caucásica de cualquier nacionalidad (North et al., 1999 (46); Yang et al, 2009 (47)). Esto puede ser indicativo de que las diferencias entre los polimorfismo de ACTN3 pueden no ser relevantes a la hora de determinar el rendimiento en un deporte de conjunto complejo como el voleibol, donde pueden factores técnicos, tácticos y condicionales pueden influir en mayor medida en el proceso de selección de jóvenes talentos. Los resultados del vasto lateral muestran diferencias significativamente mayores de Vrn en el genotipo RX frente al genotipo RR. Algunos autores defienden una relación positiva entre los deportes de potencia y/o velocidad y el polimorfismo RR, y una relación negativa entre la capacidad de generar fuerza rápida y el polimorfismo XX (Yang et al, 2003 (4); Eynon et al, 2009 (48); MacArthur et al, 2007 (8)), aunque la influencia del género parece ser evidente, de tal modo que la asociación genotipo-fenotipo en las mujeres es más fuerte que en los hombres (Yang et al., 2003 (4)). Sin embargo, otros autores defienden la idea de que no siempre se presenta este tipo de relación (Lucia et al. 2007 (5); Santiago et al., 2010 (7)). Estos resultados discordantes pueden ser debidos a la influencia de variables morfológicas y/o condicionales de los sujetos, debidas por ejemplo, a la importancia de la talla en el voleibol, al nivel de entrenamiento y al puesto específico del jugador. Esta misma justificación puede aplicarse a los datos encontrados en la respuesta del recto femoral, donde la Vrn es significativamente menor en el genotipo RR que en el RX. Sin embargo en los datos del vasto medial y del  bíceps femoral no se encontraron diferencias significativas en cuanto a la Vrn en asociación con el genotipo, pero sí una tendencia de reducción en la Vrn al enfrentar el genotipo XX con RX y RX con RR. Por lo tanto, parece claro que en los jugadores de voleibol evaluados, el genotipo XX no influye negativamente en la capacidad de rapidez de contracción muscular (Vrn) en los músculos extensores y flexores de la rodilla, afirmación que  estaría refrendada por los estudios de Lucia et al. (2007)(5) y Santiago et al. (2010)(7), y Ruiz et al. (2010)(6) que afirman que el genotipo XX no es contrario a la habilidad de generar fuerza explosiva.  

Conclusiones.

La distribución de los polimorfismos de ACTN3 en jugadores de voleibol difiere de la encontrada en población caucásica de nacionalidad española. El polimorfismo XX no se relaciona negativamente con la manifestación explosiva de la fuerza en jugadores de voleibol de alto nivel. No podemos afirmar que el gen ACTN3 sea determinante del rendimiento en el voleibol de alto nivel, existiendo otros factores fenotípicos capaces de modular dicho rendimiento.

Bibliografía

 

Responder

Otras colaboraciones